Method Article

An Optimized Sequential Isolation of Crypts and Mesenchymal Stromal Cells from Porcine Intestinal Tissue

DOI:

10.3791/69429

December 19th, 2025

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study provides a stepwise protocol for the sequential isolation of intestinal crypts and intestinal mesenchymal stromal cells (iMSCs) from porcine jejunal tissue. The method generates 2D enteroid monolayers and iMSCs suitable for developing reproducible, physiologically relevant epithelial-stromal co-culture models to investigate cellular crosstalk during intestinal homeostasis and regeneration.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The intestinal epithelium closely interacts with the underlying intestinal mesenchymal stromal cells (iMSCs) to regulate development, homeostasis, and regeneration. However, standardized methods for sequentially isolating both epithelial and stromal fractions from porcine tissue are limited. This protocol describes an optimized stepwise process for isolating crypts and iMSCs from the same jejunal segment of piglets. The method uses an ethylenediaminetetraacetic acid/dithiothreitol (EDTA/DTT)-based dissociation buffer to release crypts, followed by collagenase/dispase digestion of the extracellular matrix to isolate iMSCs. This approach minimizes spatial variations in the isolated cells. The isolated crypts were successfully cultured and formed typical expanding, two-dimensional (2D) enteroid monolayers on collagen hydrogel-coated plates. The cultured iMSCs adhered to culture flasks and expressed stromal markers such as platelet-derived growth factor receptor alpha (PDGFRα) and cluster of differentiation 81 (CD81), as determined by immunostaining. Overall, this optimized isolation protocol yields both epithelial and stromal cells from the same piglet jejunal segment, providing a reproducible foundation for future research involving intestinal organoids and iMSC co-culture systems to elucidate mechanisms controlling epithelial-stromal interactions in pigs, a translationally relevant model for replicating human physiology and advancing animal sciences.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The intestinal epithelium is a dynamic tissue that undergoes continuous self-renewal and differentiation to maintain intestinal homeostasis and facilitate regeneration after mucosal injuries1,2. Intestinal epithelial cells originate from intestinal stem cells (ISCs), and they interact with diverse microenvironment factors3,4,5,6,7,8. The subepithelial compartments, mainly the lamina propria and muscularis mucosa, consist of diverse cell populations from different lineages9. Among these cell populations, intestinal mesenchymal stromal cells (iMSCs), including fibroblasts and myofibroblasts, produce trophic and growth factors that modulate ISC stemness, proliferation, and differentiation to regulate epithelial homeostasis and regeneration6,7,10,11.

To study these cellular interactions, recent studies have developed novel approaches to unravel possible mechanisms of action that drive intestinal epithelial cell and iMSC crosstalk. Co-culture systems that combine organoids with stromal or immune cells have advanced our understanding of epithelial-subepithelial cellular interactions during development, regeneration, drug screening, and disease modeling12,13,14,15,16,17. However, most organoid co-culture studies have used murine tissues, which often fail to effectively mimic human physiology and disease phenotypes, limiting their clinical translational relevance18.

In most murine intestinal isolation protocols, epithelial and stromal cells are obtained from separate tissue segments, which may yield samples that reflect slightly different characteristics, potentially affecting reproducibility across experiments19,20. Currently, there are no standardized optimized protocols for isolating porcine intestinal crypts and iMSCs from the same tissue sample. Moreover, practical limitations in obtaining suitable human intestinal samples have led many researchers to rely on mismatched cell types from different organs (such as human enteroids with skin fibroblasts) to evaluate epithelial-mesenchymal cellular crosstalk, potentially confounding data interpretation21,22,23.

Although a recently published human intestinal biopsy protocol isolated crypts and obtained fibroblasts through outgrowth from the leftover epithelium-depleted tissue, comparable standardized approaches are lacking in pigs24. Pigs are used as a suitable animal model for translational research due to their anatomic and physiologic resemblance to humans2,18,25,26,27,28,29. Therefore, this method presents a sequential isolation protocol that recovers intestinal crypts and iMSCs from the same porcine jejunal segment based on the physiologic, anatomic, and morphologic structure of the intestine4,30. The procedure provides a reproducible framework for isolating both crypts and iMSCs suitable for future porcine intestinal co-culture studies.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A 5 cm segment was dissected from the excised proximal jejunum of 21-day-old piglets housed in the pig facility at the University of Maryland, College Park. The procedure (R-JUN-22-30) used to sacrifice the piglet followed guidelines for animal care and use policies approved by the university's Institutional Animal Care and Use Committee. Before proceeding with the isolation steps, the protocol outline is presented in Figure 1, and the list of reagents and equipment used for the sequential isolation of the porcine intestinal crypts and iMSCs is provided in the Table of Materials.

1. Pre-isolation preparation stage

  1. Prepare 30 mL of wash buffer per 5 cm tissue segment in 50 mL conical tubes.
  2. Adjust the volume based on the number of tissue samples collected.
    NOTE: Check Table 1 for wash buffer composition. All tissue preparation and cell isolation steps are done on a benchtop.

2. Intestinal tissue preparation stage

  1. Place the excised intestinal tissue into the 30 mL of wash buffer in 50 mL conical tubes.
    NOTE: The excised tissues can be placed in a cold wash buffer for an hour before use.
  2. Flush the tissue 3× with chilled wash buffer using a 21 G syringe to remove luminal contents.
  3. Place the tissue on a sterilized polystyrene foam surface and carefully remove the mesenteric and adipose tissue from the serosa.
  4. Dissect the tissue longitudinally using a surgical blade to open the lumen (Figure 2A).
  5. Transfer the partially cleaned dissected tissue into fresh wash buffer and wash twice, or until the buffer becomes clear.
  6. Place the tissue into the wash buffer in a 100 mm Petri dish and cut it into 10-15 mm pieces using a new surgical blade (Figure 2B,C). This step increases the surface area exposed to the digestion buffer.
  7. Transfer the minced tissue into a new 50 mL conical tube.
  8. Wash gently with wash buffer and allow the minced tissue to settle by gravity for approximately 30 s (Figure 2D).
  9. Gently aspirate the supernatant, leaving only enough buffer to cover the tissue pieces in the conical tube.
  10. Epithelial dissociation stage
    1. Add 30 mL of prewarmed epithelial dissociation buffer (Table 2) and incubate for 20-30 min at 37 °C in a static bead bath or a shaking water bath at approximately 9 × g.
    2. Gently shake the tube every 15 min to increase the release of the crypts from the epithelial membrane.
    3. Allow the tissue to settle and gently aspirate the supernatant with a serological pipette, leaving only enough buffer to cover the settled tissue in the conical tube.
    4. Add 30 mL of fresh wash buffer to the settled tissue and shake vigorously to release the villi, crypts, and debris (Figure 3A). Let the tissue remnants settle, then gently decant the wash buffer supernatant, which contains the suspended crypt segments, through a 100 µm cell strainer into a new 50 mL conical tube.
      1. Repeat the process of adding fresh wash buffer to the remnant tissue and decanting three times (3×). Pipette 10 µL of wash buffer containing the crypts into a 100 mm Petri dish and examine the crypt density under a stereo microscope.
        NOTE: Keep each wash buffer containing crypts after every wash.
    5. After the third wash, the wash buffer containing the crypts should be clear with minimal debris (Figure 3B).
      NOTE: Keep the tissue remnants with the extracellular matrix (ECM) in the conical tube for subsequent iMSC isolation processing.
    6. Centrifuge the crypt suspension at 150 × g for 2 min at room temperature to pellet the crypt fragments.
    7. Aspirate and resuspend the crypt pellet in epithelial culture medium.
    8. Centrifuge the resuspended crypts again at 150 × g for 2 min to collect the crypt fragment pellet.
    9. Add epithelial culture medium to resuspend the crypts and pipette 5× using a 1,000 µL pipette tip.
    10. Seed approximately 100 resuspended crypts onto pre-prepared collagen type 1 hydrogel-coated 6-well plates to culture and expand the crypts into two-dimensional (2D) enteroid monolayers.
      NOTE: Check the collagen hydrogel-coated plate preparation in Table 3. The final collagen type 1 concentration should be 1.0 mg/mL. Avoid plating excessively dense crypts or debris fragments to prevent yeast or fungal contamination. Antibiotic-antimycotic (anti-anti) in the wash buffer and culture medium should provide protection.
    11. Examine cells under an inverted phase-contrast microscope before incubating at 37 °C in a humidified 5% CO2 incubator.
    12. Replace the culture medium within 12 h after seeding to remove floating debris and reduce bacterial contamination.
    13. Grow the enteroids using epithelial culture medium (Table 4) and replace the medium every other day until around day 8, when the expanded 2D monolayers reach ≥85 % confluence for subculturing.
  11. Extracellular matrix dissociation stage
    NOTE: Continue the isolation process with the leftover tissue fragments that contain the extracellular matrix in the conical tube (Figure 3C and Figure 4A).
    NOTE: Although EDTA in the epithelial dissociation buffer can inhibit collagenase activity, the previous three washing steps remove all EDTA and DTT. Thus, collagenase activity should not be affected in the subsequent process.
    1. Mince the remaining tissue again into small pieces before proceeding to isolate the iMSCs in the lamina propria.
    2. Add 25 mL of extracellular digestion buffer (Table 5) to the tissue and incubate in a static bead bath for 15-20 min at 37 °C (Figure 4B).
    3. Shake vigorously after incubation.
      NOTE: The supernatant will become cloudy with fewer floating tissue fragments. Pipette 10 µL of the supernatant under an inverted microscope to examine the density of the iMSCs in the supernatant. Continue incubating the tissue in the beadbath for an extra 15 min if the observed iMSC density is low.
    4. Gently decant the supernatant (immediately after vigorous shaking in step 2.2.3) through a 100 µm cell strainer into a new conical tube to minimize debris.
    5. Centrifuge the cell suspension at 280 × g for 5 min at room temperature to pellet the iMSCs.
    6. Aspirate the supernatant and resuspend the iMSCs in mesenchymal culture medium (see iMSC culture media in Table 6).
    7. Centrifuge the resuspended iMSCs again at 280 × g for 5 min to wash off the dissociation buffer.
    8. Aspirate and resuspend the iMSCs in mesenchymal culture medium.
    9. Plate the iMSCs in a T75 culture flask at approximately 5 × 105 cells per flask.
      NOTE: Ensure the plated cells cover approximately 60% of the flask surface area because mesenchymal cells require moderate to high seeding density for optimal growth.
    10. Replace the culture medium within 12 h after plating to remove excess debris and prevent bacterial contamination.
    11. Examine fibroblast-like cells under an inverted phase-contrast microscope on day 2 post-seeding.
      NOTE: Change the mesenchymal culture medium every other day. The iMSCs should reach approximately 85 % confluence and be ready for subculturing by day 4.

3. Immunocytochemistry assay

  1. Culture approximately 5,000 iMSCs per well in a 96-well plate with mesenchymal culture medium for 2-3 days until cells reach approximately 80% confluence.
  2. Gently aspirate the medium and rinse the cultured iMSCs twice with 100 µL of 1× PBS/well at room temperature31. All references to the immunostaining kits are provided in the Table of Materials.
  3. Add 100 µL of 4% paraformaldehyde (PFA) per well to fix the cultured iMSCs and incubate on a static benchtop at room temperature for 30 min.
  4. Wash the fixed cultured iMSCs twice with 100 µL of 0.1% Tween-20/PBS (PBST) for 5 min each, and then permeabilize with 100 µL of 0.5% Triton X-100/PBS for 30 min.
  5. Add 100 µL of 5% bovine serum albumin (BSA)/PBST per well to block nonspecific binding on the fixed cells.
    NOTE: Leave at room temperature for 1 h before washing twice with 100 µL of PBST for 5 min each.
  6. Add 100 µL of diluted primary antibodies (1:250; i.e., 1 µL of primary antibody in 250 µL of antibody diluent) to each well and incubate the cells overnight at 4 °C. The primary antibodies used are PDGFRα and CD81.
    NOTE: Include negative control wells by adding only antibody diluent without primary antibodies.
  7. On the second day, wash off the primary antibodies twice with 100 µL of PBST for 5 min each.
  8. Dilute the secondary antibodies in 1× PBS using the following ratios: Alexa Fluor Plus 555 (1 µL:100 µL), Alexa Fluor Plus 647 (1 µL:100 µL), and DAPI (1 µL:800 µL).
  9. Counterstain the cells with the diluted secondary antibodies at room temperature for 1 h.
  10. Wash the cells twice with 1× PBS for 5 min each.
  11. Add 100 µL of mounting medium per well, cover the plate, wrap it with aluminum foil, and store at 4 °C for up to 6 months until fluorescent imaging.

4. RNA isolation and qPCR assay

  1. Extract total mRNA from iMSCs cultured in T75 flasks using the acid guanidinium thiocyanate-phenol-chloroform separation technique.
    NOTE: Determine RNA concentration and purity using a spectrophotometer.
  2. Reverse transcribe total mRNA into cDNA to use as a template for the quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay to verify amplification plots for the selected Sus scrofa gene primer, GAPDH (forward: ATCCTGGGCTACACTGAGGAC; reverse: AAGTGGTCGTTGAGGGCAATG), as reported in previous studies2,28.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

During epithelial dissociation, ethylenediaminetetraacetic acid (EDTA) chelates calcium ions to disrupt calcium-dependent cell-cell adhesions, while dithiothreitol (DTT) cleaves disulfide bonds in mucin glycoproteins to facilitate mucolysis. Thus, the combined use of a chelating compound (EDTA) and a reducing agent (DTT) enables effective release of crypts from the epithelial membrane without disrupting the extracellular matrix (ECM) structure2,32 (

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Isolating intestinal crypts and iMSCs from the same porcine jejunal segment offers a novel approach for preserving tissue segment-specific cellular and functional characteristics. This is crucial because intestinal tissues exhibit regional and spatial identities, as demonstrated in previous porcine studies2,36,37,38. Prior organoid studies in pigs or other species, which relied on crypts isolat...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors appreciate financial support from the MAES Competitive Grant Program at the University of Maryland, College Park, USA.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.5M EDTAPromegaPR-V4231
1 M HEPES bufferThermoFisher15630080For collagen hydrogel plate preparation
1000 uL pipet tipsAlkali Scientific FT1000104027-530
10x PBSInvitrogenAM9624For collagen hydrogel plate preparation
1N sodium hydroxideThermoSS266-1For collagen hydrogel plate preparation
1x HBSSThermoFisher14025092
1X PBSHycloneSH30256FS
4 % paraformaldehyde (PFA)ThermoFisherAAJ61899AK
50 mL conical tubesThermoFisher12-565-271
6 well platesFisherbrandFB012927
7.5% Sodium Bicarbonate SolutionCorningMT25035CIFor collagen hydrogel plate preparation
Advance DMEM/F12 Gibco 12634-010
Alexa fluor plus 647InvitrogenA32728Secondary antibody
Alexa plus 555 - A32732 InvitrogenA32732Secondary antibody
Aluminum foilReynoldshttps://www.amazon.com/dp/B00M8ZEAW4?ref=fed_asin_title&th=1
ANTI-ANTIGibco15240096
B27ThermoFisher12587010
BSAFisherbrandBP1600-100
CD81 Proteinintech66866-1-igPrimary antibody
Cell Culture Grade WaterHycloneSH30529FSFor collagen hydrogel plate preparation
Collagen, Type 1Corning356236For collagen hydrogel plate preparation
Collagenase IVGibco17104019
Corning 100 mm petri dishCorning07-202-011
Cryostor cell cryopreservation mediaStemcell Technologies7930
cryovial for cells Fisherbrand1050026
Dako antibody diluentDako/AgilentPart number: S302283-2primary antibody diluent
Dako fluorescent mounting mediaDako/AgilentPart number: S302380-2
DAPIPromocell/VWR10180-470DNA staining
Dispase IIRoche4942078001
DMEM, high glucoseCorningMT10013CV
DTTSigma646563
EGFPeprotech315-09
FBS (HI)Avantor1300-500H
GastrinAnaspecAS-64149
GentamicinMP BiomedicalsICN1676045
GlutaMaxThermoFisher35050061
HEPESThermoFisher15630-080
Inverted flourescent microscrropeNikonECLIPSE Ti2Flourescent imaging
Inverted phase-contrast microscopeNikonEclipse TS100For cultured cells imaging 
iScript Advanced cDNA Synthesis KitBio-Rad1725038RT-PCR kit
iTaq Universal SYBR Green SupermixBio-Rad1725122qPCR kit
LWRN conditional mediaATCCCRL-3276LWRN media was prepared in house according to the ATCC procedure
N-acetyl cysteineMP Bio194603
Nanodrop 2000 spectrophotometerThermoFisherND 2000
NicotinamideSigmaN0636-100G
Optical 384-Well Plates with BarcodeApplied Biosystems4483285qPCR kit
PDGFRαAbcamab230457Primary antibody
Prostaglandin E2 (PGE2)Cayman chemical 14010
QuantStudio 5Applied BiosystemA28570qPCR instrument
SB202190LC LaboratoriesS-1700
Stereo microscopeNikon SMZ745
T 75 flaskFisherbrandFB012937
Triton X100FisherbrandPI85111
Trizol reagent Invitrogen15596026
Tween 20, 100% Nonionic DetergentBio-rad1706531
Y27632ApexBioA3008-200

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Gehart, H., Clevers, H. Tales from the crypt: New insights into intestinal stem cells. Nat Rev Gastroenterol Hepatol. 16 (1), 19-34 (2019).
  2. Yin, L., et al. Changes in progenitors and differentiated epithelial cells of neonatal piglets. Anim Nutr. 8 (1), 265-276 (2022).
  3. Pastula, A., Marcinkiewicz, J. Cellular interactions in the intestinal stem cell niche. Arch Immunol Ther Exp (Warsz). 67 (1), 19-26 (2019).
  4. Mccarthy, N., Kraiczy, J., Shivdasani, R. A. Cellular and molecular architecture of the intestinal stem cell niche. Nat Cell Biol. 22 (9), 1033-1041 (2020).
  5. Beumer, J., Clevers, H. Cell fate specification and differentiation in the adult mammalian intestine. Nat Rev Mol Cell Biol. 22 (1), 39-53 (2021).
  6. Pasztoi, M., Ohnmacht, C. Tissue niches formed by intestinal mesenchymal stromal cells in mucosal homeostasis and immunity. Int J Mol Sci. 23 (9), 5181(2022).
  7. Kraiczy, J., et al. Graded BMP signaling within intestinal crypt architecture directs self-organization of the Wnt-secreting stem cell niche. Cell Stem Cell. 30 (4), 433-449 (2023).
  8. Niec, R. E., et al. Lymphatics act as a signaling hub to regulate intestinal stem cell activity. Cell Stem Cell. 29 (7), 1067-1082 (2022).
  9. Paerregaard, S. I., et al. The small and large intestine contain related mesenchymal subsets that derive from embryonic gli1(+) precursors. Nat Commun. 14 (1), 2307(2023).
  10. Maimets, M., et al. Mesenchymal-epithelial crosstalk shapes intestinal regionalisation via Wnt and Shh signalling. Nat Commun. 13 (1), 715(2022).
  11. Ayansola, H., Mayorga, E. J., Jin, Y. Subepithelial stromal cells: Their roles and interactions with intestinal epithelial cells during gut mucosal homeostasis and regeneration. Biomedicines. 12 (3), 668(2024).
  12. Wang, Y., et al. Long-term culture captures injury-repair cycles of colonic stem cells. Cell. 179 (5), 1144-1159 (2019).
  13. Xia, X., et al. Mesenchymal stem cells promote healing of nonsteroidal anti-inflammatory drug-related peptic ulcer through paracrine actions in pigs. Sci Transl Med. 11 (516), eaat7455(2019).
  14. Zhang, W., et al. Dietary calcium and phosphorus amounts affect development and tissue-specific stem cell characteristics in neonatal pigs. J Nutr. 150 (5), 1086-1092 (2020).
  15. Zhou, J. Y., et al. Zinc l-aspartate enhances intestinal stem cell activity to protect the integrity of the intestinal mucosa against deoxynivalenol through activation of the Wnt/beta-catenin signaling pathway. Environ Pollut. 262, 114290(2020).
  16. Yang, S., et al. Organoids: The current status and biomedical applications. MedComm (2020). 4 (3), e274(2023).
  17. Zhao, Z., et al. Organoids. Nat Rev Methods Primers. 2 (1), 94(2022).
  18. Gonzalez, L. M., Moeser, A. J., Blikslager, A. T. Porcine models of digestive disease: The future of large animal translational research. Transl Res. 166 (1), 12-27 (2015).
  19. Nieuwenhuis, T. O., et al. Patterns of unwanted biological and technical expression variation among 49 human tissues. Lab Invest. 104 (6), 102069(2024).
  20. Pastula, A., et al. Three-dimensional gastrointestinal organoid culture in combination with nerves or fibroblasts: A method to characterize the gastrointestinal stem cell niche. Stem Cells Int. 2016, 3710836(2016).
  21. Kraski, A., et al. Structured multicellular intestinal spheroids (SMIS) as a standardized model for infection biology. Gut Pathog. 16 (1), 47(2024).
  22. Darling, N. J., Mobbs, C. L., Gonzalez-Hau, A. L., Freer, M., Przyborski, S. Bioengineering novel in vitro co-culture models that represent the human intestinal mucosa with improved Caco-2 structure and barrier function. Front Bioeng Biotechnol. 8, 992(2020).
  23. Freer, M., Cooper, J., Goncalves, K., Przyborski, S. Bioengineering the human intestinal mucosa and the importance of stromal support for pharmacological evaluation in vitro. Cells. 13 (22), 1859(2024).
  24. Meran, L., Tullie, L., Eaton, S., De Coppi, P., Li, V. S. W. Bioengineering human intestinal mucosal grafts using patient-derived organoids, fibroblasts and scaffolds. Nat Protoc. 18 (1), 108-135 (2023).
  25. Burrin, D., et al. Translational advances in pediatric nutrition and gastroenterology: New insights from pig models. Annu Rev Anim Biosci. 8, 321-354 (2020).
  26. Lunney, J. K., et al. Importance of the pig as a human biomedical model. Sci Transl Med. 13 (621), eabd5758(2021).
  27. Barnett, A. M., et al. Porcine colonoids and enteroids keep the memory of their origin during regeneration. Am J Physiol Cell Physiol. 320 (5), C794-C805 (2021).
  28. Gonzalez, L. M., Williamson, I., Piedrahita, J. A., Blikslager, A. T., Magness, S. T. Cell lineage identification and stem cell culture in a porcine model for the study of intestinal epithelial regeneration. PLoS One. 8 (6), e66465(2013).
  29. Stieler Stewart, A., Freund, J. M., Blikslager, A. T., Gonzalez, L. M. Intestinal stem cell isolation and culture in a porcine model of segmental small intestinal ischemia. J Vis Exp. (135), e57647(2018).
  30. Meran, L., Baulies, A., Li, V. S. W. Intestinal stem cell niche: The extracellular matrix and cellular components. Stem Cells Int. 2017, 7970385(2017).
  31. Mahe, M. M., et al. Establishment of gastrointestinal epithelial organoids. Curr Protoc Mouse Biol. 3 (4), 217-240 (2013).
  32. Koliaraki, V., Kollias, G. Isolation of intestinal mesenchymal cells from adult mice. Bio-Protocol. 6 (18), 1940(2016).
  33. Chang, C. W., et al. Mesenchymal stem cell seeding of porcine small intestinal submucosal extracellular matrix for cardiovascular applications. PLoS One. 11 (4), e0153412(2016).
  34. Chen, J., et al. Human intestinal organoid-derived PDGFRα+ mesenchymal stroma enables the proliferation and maintenance of Lgr4+ epithelial stem cells. Stem Cell Res Ther. 15 (1), 16(2024).
  35. Beaumont, M., et al. Intestinal organoids in farm animals. Vet Res. 52 (1), 33(2021).
  36. Wiarda, J. E., Becker, S. R., Sivasankaran, S. K., Loving, C. L. Regional epithelial cell diversity in the small intestine of pigs. J Anim Sci. 101, skac318(2023).
  37. Vermeire, B., Gonzalez, L. M., Jansens, R. J. J., Cox, E., Devriendt, B. Porcine small intestinal organoids as a model to explore etec-host interactions in the gut. Vet Res. 52 (1), 94(2021).
  38. Wiarda, J. E., Trachsel, J. M., Sivasankaran, S. K., Tuggle, C. K., Loving, C. L. Intestinal single-cell atlas reveals novel lymphocytes in pigs with similarities to human cells. Life Sci Alliance. 5 (10), e202201442(2022).
  39. Uniken Venema, W. T. C., et al. Gut mucosa dissociation protocols influence cell type proportions and single-cell gene expression levels. Sci Rep. 12 (1), 9897(2022).
  40. Schaaf, C. R., et al. A lgr5 reporter pig model closely resembles human intestine for improved study of stem cells in disease. FASEB J. 37 (6), e22975(2023).
  41. Joo, S. S., et al. Porcine intestinal apical-out organoid model for gut function study. Animals (Basel). 12 (3), 372(2022).
  42. Gomez-Martinez, I., et al. A planar culture model of human absorptive enterocytes reveals metformin increases fatty acid oxidation and export. Cell Mol Gastroenterol Hepatol. 14 (2), 409-434 (2022).
  43. Jacob, J. M., et al. Pdgfralpha-induced stromal maturation is required to restrain postnatal intestinal epithelial stemness and promote defense mechanisms. Cell Stem Cell. 29 (5), 856-868 (2022).
  44. Modina, S. C., et al. Stages of gut development as a useful tool to prevent gut alterations in piglets. Animals (Basel). 11 (5), 1412(2021).
  45. Tang, W., et al. Ileum tissue single-cell mRNA sequencing elucidates the cellular architecture of pathophysiological changes associated with weaning in piglets. BMC Biol. 20 (1), 123(2022).
  46. Dong, X., et al. Identification of optimal reference genes for gene expression normalization in human osteosarcoma cell lines under proliferative conditions. Front Genet. 13, 989990(2022).
  47. Mccarthy, N., et al. Distinct mesenchymal cell populations generate the essential intestinal BMP signaling gradient. Cell Stem Cell. 26 (3), 391-402 (2020).
  48. Mussard, E., et al. Culture of piglet intestinal 3d organoids from cryopreserved epithelial crypts and establishment of cell monolayers. J Vis Exp. (192), e64917(2023).
  49. Zhang, M., et al. Long-term expansion of porcine intestinal organoids serves as an in vitro model for swine enteric coronavirus infection. Front Microbiol. 13, 865336(2022).
  50. Benz, P., Plenge, M., Wagner, S., Mazzuoli-Weber, G. Two-dimensional porcine intestinal organoids reflecting the physiological properties of native gut. J Vis Exp. (215), e67666(2025).
  51. Lee, B. R., Ock, S. A., Park, M. R., Lee, M. G., Byun, S. J. Establishing porcine jejunum-derived intestinal organoids to study the function of intestinal epithelium as an alternative for animal testing. J Anim Reproduction Biotechnol. 39 (1), 2-11 (2024).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Crypt IsolationEDTA DTT DissociationCollagenase DigestionEnteroid MonolayersCollagen HydrogelStromal MarkersEpithelial Stromal Interactions
Video Coming Soon

Related Articles