A Digital Microfluidic Electroporation Platform for Low-input CRISPR Genome Editing and mRNA Transfection In Suspension T Cells and 3D Cell Models

Summary

This protocol describes miniaturized CRISPR–Cas9 genome editing of TCRα/β receptor in primary human T cells using ‘DMF-ection’, a digital microfluidic (DMF) electroporation platform. The method enables parallel, low-input gene editing with high viability and is further adaptable for mRNA delivery into multicellular 3D spheroids.

Abstract

Digital microfluidic (DMF) electroporation enables precise, low-volume genetic manipulation of mammalian cells while minimizing cellular input by up to 100x and preserving viability. This study presents a high-throughput DMF-based transfection workflow for CRISPR-mediated knockout of the TRAC locus in primary human suspension T cells and for mRNA transfection of three-dimensional HEK293T spheroids. Using spatially deposited CRISPR guide RNAs and on- cartridge ribonucleoprotein (RNP) assembly, efficient TRAC locus disruption was achieved in both CD4⁺ and CD8⁺ T-cell populations using only 10,000 cells per condition, with post-editing viabilities exceeding 85%. Biophysical characterization using flow-induced and Taylor dispersion analyses revealed that polymer additives stabilize Cas9–sgRNA complexes under electroporation buffer conditions, supporting reproducible editing at sub microliter volumes. The workflow was further adapted for 3D applications by delivering EGFP mRNA into intact HEK293T spheroids, resulting in robust and spatially uniform fluorescence without impairing spheroid growth or morphology. Together, these results demonstrate that DMF electroporation enables efficient genome editing and mRNA delivery across both suspension immune cells and multicellular spheroids. This platform provides a scalable and low-input solution for applications in CAR-T cell therapy, functional genomics, and advanced 3D cellular models.

Introduction

Gene editing in primary human cells is increasingly central to both therapeutic development and basic research, including applications in immuno-engineering, rare disease modeling, and functional genomics¹. Although electroporation enables highly efficient genome editing, conventional cuvette-based systems typically require up to millions of cells per condition, restricting their use for patient-derived samples and rare immune populations². In addition, these systems are poorly suited for large-scale screening due to limitations in throughput, automation, and reagent consumption³.

Microfluidic electroporation has emerged as a promising approach for low-input genome editing⁴. However, most existing platforms rely on continuous flow architectures that involve complex fluid handling, limited flexibility in reagent mixing, and relatively high per-condition cell requirements. In contrast, digital microfluidics (DMF) enables active manipulation of discrete nanoliter-scale droplets on a planar electrode array, allowing precise control over reaction composition, timing, and spatial localization. This plug-and-play droplet-based format is well-suited for low-volume, high-throughput workflows where conservation of primary cells and reagents is essential⁵.

Recent work has demonstrated the feasibility of DMF-based intracellular delivery using tri-droplet electroporation architectures that generate localized, low-current electric fields for efficient RNP and mRNA delivery while minimizing thermal and electrochemical stress^6,7,8. Building on this foundation, a next-generation DMF electroporation platform, termed ‘DMF-ection’ featuring 48 independently addressable reaction sites, full automation compatibility, and scalable cartridge manufacturing⁹ (Figure 1) was developed. The DMF cartridge consists of a bottom PCB plate and a plastic top plate separated by a gasket, assembled via alignment snaps in a single correct orientation (Figure 1A). The 48-plex layout is organized into eight identical families (Figure 1A–H), each containing six independently addressable electroporation sites, supporting up to 48 parallel editing conditions per cartridge (Figure 1B). Guide RNA libraries are deposited onto the substrate surface using an acoustic dispenser prior to cartridge assembly. Positional accuracy of deposition was confirmed across all 48 sites, with drop positions clustering within sub-millimeter deviation from the electrode midpoint (Figure 1C), supporting reliable on-cartridge RNP assembly. Following loading, cells and liquid electrode droplets are actuated on-cartridge to form the tri-droplet electroporation geometry (Figure 1D). After electroporation, cells are offloaded into culture plates for recovery and downstream analysis, including flow cytometry, sequencing, and microscopy (Figure 1E). This system enables high-efficiency genome editing using up to 100-fold fewer cells than standard cuvette-based methods, significantly expanding access to genome engineering in low-input and high-throughput applications.

This study assesses the platform’s performance by delivering multiple biomolecular cargoes, including mRNA and CRISPR–Cas9 ribonucleoprotein (RNP) complexes, achieving efficient transfection and gene disruption. In addition to primary T cells, DMF-ection provides a generalizable framework for delivering nucleic acids into complex multicellular structures. Three-dimensional (3D) spheroids and organoid-type models impose significant barriers to reagent penetration due to their architecture and fragility, and conventional electroporation approaches often disrupt morphology or generate heterogeneous delivery. To assess whether the same miniaturized electroporation principles used for T-cell editing extend to structured tissues, the DMF workflow was applied to 3D HEK293T spheroids. These experiments demonstrated that DMF-based electrowetting can gently position intact spheroids within tri-droplet geometries and support uniform mRNA delivery while preserving structure and growth. Although these results are outside the primary T-cell protocol described here, they illustrate the broader applicability of programmable DMF electroporation for emerging 3D cellular systems relevant to drug discovery and disease modeling.

Protocol

Primary human T cells used in this protocol were obtained from commercial suppliers under informed donor consent and in compliance with applicable institutional, ethical, and regulatory guidelines. All handling of human-derived biological materials was conducted in accordance with institutional biosafety protocols. Researchers implementing this protocol are responsible for ensuring that their use of primary human cells complies with local institutional review board (IRB) or ethics committee requirements, applicable biosafety regulations, and any relevant national or regional legislation governing the use of human biological material. No patient-identifiable information was associated with the cell material used in this study.

1. Preparation and activation of primary human T cells

1. Thaw cryopreserved primary human CD3⁺ T cells rapidly in a 37 °C water bath. Transfer the cells to prewarmed basal T-cell medium and centrifuge at 180 × g for 10 min. Discard the supernatant and resuspend the pellet in fresh medium.
2. Determine cell concentration and viability using an automated cell counter.
3. Resuspend cells at 1 × 10⁶ cells/mL in T-cell culture medium supplemented with a soluble tetrameric antibody CD3/CD28 T-cell activator stimulus (according to vendor instructions) and 200 IU/mL IL-2. Incubate cells for 72 h at 37 °C, 5% CO₂.
   NOTE: Maintain cell density between 0.5–2 × 10⁶ cells/mL during activation. Perform activation in U-bottom 96-well plates to optimize cell-to-activator contact and activation efficiency.

2. Preparation of guide RNA spots on the DMF substrate (acoustic dispenser spotting)

1. Reconstitute lyophilized sgRNA in nuclease-free water to a stock concentration of 100 µM. In a separate tube, prepare a 100 mg/mL stock of poly-L-glutamic acid (PGA, sodium salt, MW 15,000–50,000 Da) in nuclease-free water. Combine sgRNA and PGA stock at a 5:4 volume ratio (sgRNA: PGA) that yields a final sgRNA concentration of 55.6 pmol/µL and a final PGA concentration of 44.4 mg/mL in nuclease-free water. Vortex briefly and centrifuge at 1,000 × g for 30 s and aliquot into single-use volumes and store unused aliquots at −80 °C for up to 6 months.
   NOTE: Avoid repeated freeze-thaw cycles.
2. Add the guide-PGA mixture to a low-dead-volume acoustic source plate in wells corresponding to the desired reaction site layout.
3. Transfer 40 nL (equivalent to 2.2 pmol sgRNA) of the guide-PGA mixture to each target spotting region of the DMF substrate using a calibrated acoustic dispenser.
   NOTE: At 55.6 pmol/µL, 40 nL delivers 2.2 pmol sgRNA per site (55.6 × 0.040 = 2.22 pmol). Dried guides are reconstituted during droplet merging on-cartridge; complete resuspension is confirmed by consistent editing efficiency across sites.
4. In a biological safety cabinet, allow the spotted droplets to air-dry completely at room temperature until no visible liquid remains (approximately 5 min).
   NOTE: Do not use forced airflow or heat, as this may dislodge or degrade the guide RNA.
5. Assemble the DMF cartridge.
   1. In a biological safety cabinet, align the top plate over the spotted substrate by matching the asymmetrical plastic snapping features from the top plate with the notches on the bottom plate. Apply even, simultaneous pressure along the short edges until a distinct mechanical snap is felt, confirming full engagement of the locking features.
      NOTE: The cartridge is designed with a single correct orientation; incorrect assembly will not produce the snap. Hold substrates by the edges at all times to avoid contamination or damage to functional surfaces and avoid sliding the substrates against each other as this may scratch the surface coatings.
   2. Checkpoint: Confirm correct assembly by the mechanical snap.
      NOTE: There is no prerun electrical indicator of coating integrity; any functional failures resulting from improper assembly are detected automatically and reported in the post-run QC report.
      Pause point: Store unused assembled cartridges in a sealed package with desiccant (silica gel packets) at room temperature for up to 48 h.

3. Cell preparation

1. Prepare 1 mL of Complete Transfection Buffer freshly before each use by combining DMF-compatible electroporation buffer with the provided biocompatible non-ionic surfactant at a 20:1 (v/v) ratio (electroporation buffer: surfactant), yielding a final surfactant concentration of 0.05% (v/v). Mix gently and keep on ice.
   NOTE: The DMF-compatible transfection buffer used here is a low-conductivity, isotonic buffer (conductivity: 3.5 mS/cm, osmolality: 305 mOsm/L). Researchers using alternative buffers should verify compatibility with DMF actuation and cell viability. The biocompatible non-ionic surfactant serves to reduce droplet pinning; if the provided surfactant is not used, a suitable substitute.
2. Wash activated T cells once with Transfection Buffer (containing no surfactant). Centrifuge at 180 × g for 5 min, aspirate the supernatant, and resuspend the cell pellet in Complete Transfection Buffer (containing surfactant) at 1.0 × 10⁷ cells/mL in a total volume of 100 µL per cartridge. Keep on ice.
3. Immediately before loading onto the cartridge, add Cas9 nuclease directly to the 100 µL of T-cell suspension and mix by gentle pipetting; keep on ice.
   NOTE: For primary T cells, Cas9 is loaded at 42 pmol per 100 µL cartridge volume (0.42 pmol/µL). Each electroporation site processes approximately 1 µL of cell suspension, delivering 0.42 pmol Cas9 per edit. Optimize this dosage when adapting to other immune cell types (see Table 1).

Component	Final concentration per edit
Cas9	0.42 pmol in ~1 µL droplet
sgRNA	2.1 pmol (from 40 nL spot)
PGA	44.4 mg/mL stock in spotting mix
Surfactant	0.05% (v/v)
Cell input	~10,000 cells

Table 1: Summary table of final concentrations in each transfection droplet.

4. Transfection on the DMF-ection platform

1. Using a multichannel pipette, dispense 10 µL of the T-cell/Cas9 mixture into each of the 8 cell loading ports, and 10 µL of complete Transfection Buffer into the 16 liquid electrode loading ports (as shown in Figure 1).
2. Set the voltage to 500 V, pulse duration to 3 ms, and number of pulses to 2. Initiate the electroporation sequence according to the platform instructions.
   1. Checkpoint: Review the postrun QC report immediately after the run. Sporadic failures (<10% of sites) require no intervention. If failures are systematic, replace the cartridge with the provided QC board, run the System Health Check (~2 min), and contact technical support if issues persist.

5. Offloading and recovery of edited T cells

1. Using a liquid handler, transfer electroporated cells from each reaction site into a 96-well U-bottom plate containing 150 µL of prewarmed basal T-cell medium supplemented with 200 IU/mL IL-2.
2. Incubate cells for 72 h at 37 °C, 5% CO₂ to permit protein turnover and surface receptor expression changes.

6. Flow cytometry analysis of TRAC knockout

1. Transfer cells to a sterile 96-well conical bottom plate to reduce cell loss between washes. Wash cells twice with Flow Cytometry Buffer (1× PBS, 2% FBS, 2 mM EDTA) by centrifuging at 400 × g for 5 min and removing the supernatant by gently inverting the conical bottom plate. Cells will remain pelleted in the plate.
2. Prepare a surface staining master mix containing anti-CD4, anti-CD8, and anti-TCRα/β antibodies in Flow Cytometry Buffer at manufacturer-recommended concentrations. Add 25 µL of the master mix per well and incubate for 20 min at 4 °C protected from light. Wash twice with 1× PBS (without FBS) by centrifuging at 400 × g for 5 min. Resuspend cells in 100 µL of 1× PBS containing a viability dye at 1:1,000 (v/v) and incubate for 10 min at room temperature protected from light.
   NOTE: Conical bottom plates are effective at pelleting cells; check that cells are well resuspended in all steps.
3. Wash cells twice with Flow Cytometry Buffer and resuspend in 150–200 µL per sample for acquisition.
4. Configure the cytometer with appropriate laser lines and filter sets for the fluorochromes used (e.g., 488 nm excitation for viability dye; 405 nm or 488 nm for surface markers as appropriate). Set voltages using single-stain compensation controls and an unstained sample. Collect a minimum of 5,000 live singlet events per sample. Gate sequentially on: scatter singlets → live cells (viability dye negative) → CD4⁺ or CD8⁺ → TCRα/β expression.
   NOTE: Under standard conditions, total live events acquired can range from 5,000 to over 10,000 per sample following losses during washing and staining, given that the cells have had time to proliferate.
5. Determine TRAC gene disruption by measuring the frequency of TCRα/β-negative cells within the CD4⁺ and CD8⁺ populations. Report knockout efficiency as the percentage of TCRα/β-negative cells relative to the live singlet gate for each subset.

Results

Expected outcomes
Electroporation of 10,000 activated T cells per condition typically results in >85% TRAC knockout efficiency with >95% viability 72 h post-transfection. Flow cytometry reveals a clear loss of TCRα/β staining in the TRAC-targeting condition relative to non-targeting sgRNA controls (NTC) and controls not exposed to any electric fields. Unless otherwise stated, n represents independent DMF-ection runs performed on separate days. Technical replicates from the same cartrid...

Discussion

This protocol describes a miniaturized digital microfluidic electroporation workflow that enables efficient intracellular delivery into primary human T cells using nanoliter-scale droplets. A central advantage of this method is the ability to perform CRISPR–Cas9 genome editing using only 10,000 cells per reaction, dramatically reducing material requirements compared to conventional electroporation. The droplet-based architecture supports automation, ensuring reproducible reagent handling and reaction assembly acros...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
12 Channel VOYAGER Adjustable Tip Spacing Pipette	Integra	4732	Instrumentation
1x PBS	Gibco		Flow Buffer
96 Well Plate, Sphera Low-Attachment Surface	Thermo Fisher	174927	Spheroid protocol
96-well conical-bottom plate	Sarstedt	82.1583.001	Spheroid protocol
Alexa Fluor 647 anti-human CD4 Antibody	Biolegend	357421	1 in 200, Clone A161A1
Attune Flow Cytometer	ThermoFisher		Instrumentation
DMEM Media	Gibco	10564011	Media Supplement- Spheroid culture
DMF compatible buffer	DropGenie		Transfection
DropGenie Transfection System	DropGenie		Instrumentation
Echo Acoustic Dispenser 650 Series	Beckman Coulter Life Scienes
Echo Qualified 384-well Low Dead Volume	Beckman Coulter Life Scienes
EDTA	Invitrogen		Flow Buffer
EGFP mRNA	Trilink	L-7201
EVOS Fluorescent Microscope	ThermoFisher		Instrumentation
Fetal Bovine Serum	Gibco	16000044	Media Supplement- Spheroid culture
Fida 1 instrument and Fida Neo 480 nm detector	Fida Biosystems ApS		Instrumentation
Ghost Dye Violet 510	Cytek Biosciences	13-0870
HEK293T Cells	ATCC		Spheroid protocol
Human IL-2 Recombinant Protein,	Peprotech	200-02 50ug	T cell media supplement
Human Primary Pan CD3+ T Cells	All Cells		Peripheral Blood, Cryopreserved, pan CD3+ Helper T Cells, Negatively Selected
Immunocult CD3/CD28 Activator	StemCell Technologies	10970	T Cell Activation media
Immunocult Expansion Media	StemCell Technologies	10981	T Cell Activation media
Incucyte Live Cell Analysis System	Sartorius		Instrumentation
INTEGRA ASSIST PLUS pipetting robot	Integra	4505, 4-Position Portrait Deck (PN 4521),	Instrumentation
non targeting synthetic guide RNA	Synthego		5’ GCACTACCAGAGCTAACTCA 3'
NucleoCounter NC-202	Chemometec
PE anti-human TCR α/β Recombinant Antibody	Biolegend	380805	1 in 200, Clone QA20B12
PE-Cy 7 Anti-Human CD8	BD Pharmingen	557750	1 in 200, Clone RPA-T8
Penicillin-Streptomycin (10,000 U/mL)	Gibco	15140122	Media Supplement- Spheroid culture
Poly-L-glutamic Acid (PGA)	Sigma Aldrich	P4761-100MG	Use a at 100mg/ml
Prism version 8.0.0	GraphPad Software, Inc.		Software
sNLS-SpCas9-sNLS Nuclease	IDT	10017687
Spheroid Microplate	Corning	3830	Spheroid protocol
Surfactant F	DropGenie		Transfection- use at 1:20 in DMF compatible buffer to make compete Transfection buffer
TRAC synthetic guide RNA	Synthego		5’ AGAGTCTCTCAGCTGGTACA 3'
Trypsin-EDTA (0.05%), phenol red	Gibco	25-300-062	Spheroid protocol